Review



nucleotide sequences encoding the heavy chain variable region and the light chain variable region  (GenScript corporation)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    GenScript corporation nucleotide sequences encoding the heavy chain variable region and the light chain variable region
    Nucleotide Sequences Encoding The Heavy Chain Variable Region And The Light Chain Variable Region, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucleotide sequences encoding the heavy chain variable region and the light chain variable region/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    nucleotide sequences encoding the heavy chain variable region and the light chain variable region - by Bioz Stars, 2026-05
    90/100 stars

    Images



    Similar Products

    sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga  (Bethyl)
    94
    Bethyl sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga
    Sequence Based Reagents Crispr Target Sequence For Camkiiγ Human 5 ́ Gtgctgatcctcatcccaga, supplied by Bethyl, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga/product/Bethyl
    Average 94 stars, based on 1 article reviews
    sequence based reagents crispr target sequence for camkiiγ human 5 ́ gtgctgatcctcatcccaga - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    avelumab heavy and light chain sequences  (Twist Bioscience)
    90
    Twist Bioscience avelumab heavy and light chain sequences
    Avelumab Heavy And Light Chain Sequences, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/avelumab heavy and light chain sequences/product/Twist Bioscience
    Average 90 stars, based on 1 article reviews
    avelumab heavy and light chain sequences - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    nucleotide sequences encoding the heavy chain variable region and the light chain variable region  (GenScript corporation)
    90
    GenScript corporation nucleotide sequences encoding the heavy chain variable region and the light chain variable region
    Nucleotide Sequences Encoding The Heavy Chain Variable Region And The Light Chain Variable Region, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucleotide sequences encoding the heavy chain variable region and the light chain variable region/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    nucleotide sequences encoding the heavy chain variable region and the light chain variable region - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    heavy light chain dna sequences antibody fragments (fab  (Twist Bioscience)
    90
    Twist Bioscience heavy light chain dna sequences antibody fragments (fab
    Heavy Light Chain Dna Sequences Antibody Fragments (Fab, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/heavy light chain dna sequences antibody fragments (fab/product/Twist Bioscience
    Average 90 stars, based on 1 article reviews
    heavy light chain dna sequences antibody fragments (fab - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    qx008n heavy and light chain nucleic acid sequences  (GenScript corporation)
    90
    GenScript corporation qx008n heavy and light chain nucleic acid sequences
    Qx008n Heavy And Light Chain Nucleic Acid Sequences, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qx008n heavy and light chain nucleic acid sequences/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    qx008n heavy and light chain nucleic acid sequences - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    amplification of heavy and light chains and sequencing  (iRepertoire Inc)
    90
    iRepertoire Inc amplification of heavy and light chains and sequencing
    Amplification Of Heavy And Light Chains And Sequencing, supplied by iRepertoire Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplification of heavy and light chains and sequencing/product/iRepertoire Inc
    Average 90 stars, based on 1 article reviews
    amplification of heavy and light chains and sequencing - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    codonoptimized sequences of the heavy and light chains of bevacizumab  (Bioneer Corporation)
    90
    Bioneer Corporation codonoptimized sequences of the heavy and light chains of bevacizumab
    Codonoptimized Sequences Of The Heavy And Light Chains Of Bevacizumab, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/codonoptimized sequences of the heavy and light chains of bevacizumab/product/Bioneer Corporation
    Average 90 stars, based on 1 article reviews
    codonoptimized sequences of the heavy and light chains of bevacizumab - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    sequences for the heavy and light chains of anti-her2 fabs  (Twist Bioscience)
    90
    Twist Bioscience sequences for the heavy and light chains of anti-her2 fabs
    Sequences For The Heavy And Light Chains Of Anti Her2 Fabs, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequences for the heavy and light chains of anti-her2 fabs/product/Twist Bioscience
    Average 90 stars, based on 1 article reviews
    sequences for the heavy and light chains of anti-her2 fabs - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    trastuzumab expression construct sequences matching the who published sequences of the heavy and light chains of trastuzumab  (Thermo Fisher)
    90
    Thermo Fisher trastuzumab expression construct sequences matching the who published sequences of the heavy and light chains of trastuzumab
    Trastuzumab Expression Construct Sequences Matching The Who Published Sequences Of The Heavy And Light Chains Of Trastuzumab, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trastuzumab expression construct sequences matching the who published sequences of the heavy and light chains of trastuzumab/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    trastuzumab expression construct sequences matching the who published sequences of the heavy and light chains of trastuzumab - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    scfv sequence (heavy chain linked to light chain variable regions) against human cd19, fmc63  (Twist Bioscience)
    90
    Twist Bioscience scfv sequence (heavy chain linked to light chain variable regions) against human cd19, fmc63
    Scfv Sequence (Heavy Chain Linked To Light Chain Variable Regions) Against Human Cd19, Fmc63, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scfv sequence (heavy chain linked to light chain variable regions) against human cd19, fmc63/product/Twist Bioscience
    Average 90 stars, based on 1 article reviews
    scfv sequence (heavy chain linked to light chain variable regions) against human cd19, fmc63 - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier

    Image Search Results